Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dys-1
Worm sequence name:  WBGene00001131.1; Alias F15D3.1
Related human gene:  DMD
Associated human disease:  Duchenne Muscular Dystrophy
People involved in this project: 
Left primer sequence:  aaaatcatcgtcatcctcgc
Right primer sequence:  ttcacaagatgcaagttcgc
Size of PCR product:  324
Brief description:  The dys-1 gene encodes an ortholog of human DMD, which when mutated leads to Duchenne muscular dystrophy (OMIM:310200)or to the milder form Becker muscular dystrophy carried on the X chromosome. Mapping and genetic studies indicate mutations in the gene that encodes dystrophin and two-thirds are deletions of one or more exons in the dystrophin gene.
The gene dys-1 is expressed in C. elegans in body wall muscles, vulva muscles, head muscles and pharygeal muscles.
Report any problems that might have appeared and any solutions:  To be seen from experimentation
View(1) or add comments