Worm gene name: | dys-1 |
Worm sequence name: | WBGene00001131.1; Alias F15D3.1 |
Related human gene: | DMD |
Associated human disease: | Duchenne Muscular Dystrophy |
People involved in this project: |
|
Left primer sequence: | aaaatcatcgtcatcctcgc |
Right primer sequence: | ttcacaagatgcaagttcgc |
Size of PCR product: | 324 |
Brief description: | The dys-1 gene encodes an ortholog of human DMD, which when mutated leads to Duchenne muscular dystrophy (OMIM:310200)or to the milder form Becker muscular dystrophy carried on the X chromosome. Mapping and genetic studies indicate mutations in the gene that encodes dystrophin and two-thirds are deletions of one or more exons in the dystrophin gene.
The gene dys-1 is expressed in C. elegans in body wall muscles, vulva muscles, head muscles and pharygeal muscles. |
Report any problems that might have appeared and any solutions: | To be seen from experimentation |
I was successfully able to clone it in PGEMT vector and run the PCR product based on the left primer sequence.