| Worm gene name: | epi-1 |
| Worm sequence name: | K08C7.3 A |
| Related human gene: | LAMA3 |
| Associated human disease: | ALS |
| People involved in this project: |
|
| Left primer sequence: | ctgtgagcatggctactgga |
| Right primer sequence: | tggagcatctttgcaatctg |
| Size of PCR product: | 945 |
| Brief description: | This project is still in progress. Check back for results. |
| Report any problems that might have appeared and any solutions: | |
| Media attachments: |
|
