Home | Projects | Login or register:
Username:   Password:

Worm gene name:  epi-1
Worm sequence name:  K08C7.3 A
Related human gene:  LAMA3
Associated human disease:  ALS
People involved in this project: 
Left primer sequence:  ctgtgagcatggctactgga
Right primer sequence:  tggagcatctttgcaatctg
Size of PCR product:  945
Brief description:  This project is still in progress. Check back for results.
Report any problems that might have appeared and any solutions: 
Media attachments: 
  • Using a model organism to study Lou Gehrig's disease  Using a model organism to study Lou Gehrig's disease
     no description
View(2) or add comments