Worm gene name:  epi-1
Worm sequence name:  K08C7.3 A
Related human gene:  LAMA3
Associated human disease:  ALS
People involved in this project: 
Left primer sequence:  ctgtgagcatggctactgga
Right primer sequence:  tggagcatctttgcaatctg
Size of PCR product:  945
Brief description:  This project is still in progress. Check back for results.
Report any problems that might have appeared and any solutions: 
Media attachments: 
  • Using a model organism to study Lou Gehrig's disease  Using a model organism to study Lou Gehrig's disease
     no description
Epi-1 does not seem to be an orthologue to a human gene related to Lou Gehrig's disease. SOD-1 seems to be the correct orthologue.
Posted by lutz holzinger on 2008-07-31 16:25:15
Worms fed the K08C7.3 feeding vector had protruding vulvae. This result needs to be confirmed.
Posted by on 2007-09-06 11:10:33