| Worm gene name: | mrp-6 |
| Worm sequence name: | F20B6.3 |
| Related human gene: | CFTR |
| Associated human disease: | Cystic Fibrosis |
| People involved in this project: |
|
| Left primer sequence: | ttcgggcgtgaactattttc |
| Right primer sequence: | ttgagcacaataagcgaacg |
| Size of PCR product: | 507 |
| Brief description: | Source: OMIM
Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a chloride channel and controls the regulation of other transport pathways. Mutations in the CFTR gene have been found to cause cystic fibrosis and congenital bilateral aplasia of the vas deferens. |
| Report any problems that might have appeared and any solutions: | |
