Home | Projects | Login or register:
Username:   Password:

Worm gene name:  mrp-6
Worm sequence name:  F20B6.3
Related human gene:  CFTR
Associated human disease:  Cystic Fibrosis
People involved in this project: 
Left primer sequence:  ttcgggcgtgaactattttc
Right primer sequence:  ttgagcacaataagcgaacg
Size of PCR product:  507
Brief description:  Source: OMIM
Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a chloride channel and controls the regulation of other transport pathways. Mutations in the CFTR gene have been found to cause cystic fibrosis and congenital bilateral aplasia of the vas deferens.
Report any problems that might have appeared and any solutions: 
View(1) or add comments