Worm gene name: | mrp-6 |
Worm sequence name: | F20B6.3 |
Related human gene: | CFTR |
Associated human disease: | Cystic Fibrosis |
People involved in this project: |
|
Left primer sequence: | ttcgggcgtgaactattttc |
Right primer sequence: | ttgagcacaataagcgaacg |
Size of PCR product: | 507 |
Brief description: | Source: OMIM
Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a chloride channel and controls the regulation of other transport pathways. Mutations in the CFTR gene have been found to cause cystic fibrosis and congenital bilateral aplasia of the vas deferens. |
Report any problems that might have appeared and any solutions: | |