Worm gene name: |
ugt-62
|
Worm sequence name: |
M88.1
|
Related human gene: |
UDP glucuronosyltransferase 1 family, polypeptide A1
|
Associated human disease: |
Crigler-Najjar Syndrome, type II ( Arias Syndrome)
|
People involved in this project: |
|
Left primer sequence: |
gtactcgtgtggccgaagtt
|
Right primer sequence: |
agaagcccatttcatcatcg
|
Size of PCR product: |
551
|
Brief description: |
The human ortholog of the C. elegans ugt-62 gene is associated with an autosomal recessive genetic disorder in which bilirubin cannot be conjugated into its water-soluble form (bilirubin glucuronide). Homozygous recessive individuals fail to synthesize the active enzyme bilirubin glucuronyltransferase, resulting in hyperbilirubinemia and jaundice.
|
Report any problems that might have appeared and any solutions: |
|