Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ugt-62
Worm sequence name:  M88.1
Related human gene:  UDP glucuronosyltransferase 1 family, polypeptide A1
Associated human disease:  Crigler-Najjar Syndrome, type II ( Arias Syndrome)
People involved in this project: 
Left primer sequence:  gtactcgtgtggccgaagtt
Right primer sequence:  agaagcccatttcatcatcg
Size of PCR product:  551
Brief description:  The human ortholog of the C. elegans ugt-62 gene is associated with an autosomal recessive genetic disorder in which bilirubin cannot be conjugated into its water-soluble form (bilirubin glucuronide). Homozygous recessive individuals fail to synthesize the active enzyme bilirubin glucuronyltransferase, resulting in hyperbilirubinemia and jaundice.
Report any problems that might have appeared and any solutions: 
View(1) or add comments