| Worm gene name: | ugt-62 |
| Worm sequence name: | M88.1 |
| Related human gene: | UDP glucuronosyltransferase 1 family, polypeptide A1 |
| Associated human disease: | Crigler-Najjar Syndrome, type II ( Arias Syndrome) |
| People involved in this project: |
|
| Left primer sequence: | gtactcgtgtggccgaagtt |
| Right primer sequence: | agaagcccatttcatcatcg |
| Size of PCR product: | 551 |
| Brief description: | The human ortholog of the C. elegans ugt-62 gene is associated with an autosomal recessive genetic disorder in which bilirubin cannot be conjugated into its water-soluble form (bilirubin glucuronide). Homozygous recessive individuals fail to synthesize the active enzyme bilirubin glucuronyltransferase, resulting in hyperbilirubinemia and jaundice. |
| Report any problems that might have appeared and any solutions: | |
Primers successfully amplified product of ~500nt. This product was successfully ligated into L4440 and transformed into DH5alpha.