Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Y42G9A.4
Worm sequence name:  Y42G9A.4
Related human gene:  Mevalonate kinase
Associated human disease:  Mevalonic aciduria
People involved in this project: 
Left primer sequence:  caggttttcttcgcttttcg
Right primer sequence:  actgatcctcacacgaaccc
Size of PCR product:  490
Brief description:  This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Two transcript variants that encode the same protein have been found for this gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments