| Worm gene name: | Y42G9A.4 |
| Worm sequence name: | Y42G9A.4 |
| Related human gene: | Mevalonate kinase |
| Associated human disease: | Mevalonic aciduria |
| People involved in this project: |
|
| Left primer sequence: | caggttttcttcgcttttcg |
| Right primer sequence: | actgatcctcacacgaaccc |
| Size of PCR product: | 490 |
| Brief description: | This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Two transcript variants that encode the same protein have been found for this gene. |
| Report any problems that might have appeared and any solutions: | |
