Worm gene name: |
lin-35
|
Worm sequence name: |
C32F10.2
|
Related human gene: |
Rb
|
Associated human disease: |
Retinoblastoma
|
People involved in this project: |
|
Left primer sequence: |
ggtcttccaagttcgtctcg
|
Right primer sequence: |
ctggaagacgtttccgtgat
|
Size of PCR product: |
1123
|
Brief description: |
Retinoblastoma occurs in early childhood and affects about 1 child in 20,000. Tumors develop from the immature retina (the part of the eye responsible for detecting light and color). Two forms of retinoblastoma exist: hereditary and non-hereditary. A single eye is affected by a tumor in non-hereditary retinoblastoma. In contrast, hereditary retinoblastoma causes multiple tumors in both eyes. Scientists have found that the hereditary form of retinoblastoma is caused by a mutation in a gene called Rb which is found on chromosome 13. To study retinoblastoma in a model organism, we searched for related genes in C. elegans by BLAST and found that lin-35 was the most closely related gene to Rb in worms. To study lin-35, we created an RNAi feeding strain using primers we designed to amplify the gene. We haven't had a chance to test the feeding strain yet, though.
|
Report any problems that might have appeared and any solutions: |
|
Media attachments: |
|