| Worm gene name: | lin-35 |
| Worm sequence name: | C32F10.2 |
| Related human gene: | Rb |
| Associated human disease: | Retinoblastoma |
| People involved in this project: |
|
| Left primer sequence: | ggtcttccaagttcgtctcg |
| Right primer sequence: | ctggaagacgtttccgtgat |
| Size of PCR product: | 1123 |
| Brief description: | Retinoblastoma occurs in early childhood and affects about 1 child in 20,000. Tumors develop from the immature retina (the part of the eye responsible for detecting light and color). Two forms of retinoblastoma exist: hereditary and non-hereditary. A single eye is affected by a tumor in non-hereditary retinoblastoma. In contrast, hereditary retinoblastoma causes multiple tumors in both eyes. Scientists have found that the hereditary form of retinoblastoma is caused by a mutation in a gene called Rb which is found on chromosome 13. To study retinoblastoma in a model organism, we searched for related genes in C. elegans by BLAST and found that lin-35 was the most closely related gene to Rb in worms. To study lin-35, we created an RNAi feeding strain using primers we designed to amplify the gene. We haven't had a chance to test the feeding strain yet, though. |
| Report any problems that might have appeared and any solutions: | |
| Media attachments: |
|
