Worm gene name:  lin-35
Worm sequence name:  C32F10.2
Related human gene:  Rb
Associated human disease:  Retinoblastoma
People involved in this project: 
Left primer sequence:  ggtcttccaagttcgtctcg
Right primer sequence:  ctggaagacgtttccgtgat
Size of PCR product:  1123
Brief description:  Retinoblastoma occurs in early childhood and affects about 1 child in 20,000. Tumors develop from the immature retina (the part of the eye responsible for detecting light and color). Two forms of retinoblastoma exist: hereditary and non-hereditary. A single eye is affected by a tumor in non-hereditary retinoblastoma. In contrast, hereditary retinoblastoma causes multiple tumors in both eyes. Scientists have found that the hereditary form of retinoblastoma is caused by a mutation in a gene called Rb which is found on chromosome 13. To study retinoblastoma in a model organism, we searched for related genes in C. elegans by BLAST and found that lin-35 was the most closely related gene to Rb in worms. To study lin-35, we created an RNAi feeding strain using primers we designed to amplify the gene. We haven't had a chance to test the feeding strain yet, though.
Report any problems that might have appeared and any solutions: 
Media attachments: 
  • lin-35 region  lin-35 region
     This is a screenshot of the lin-35 region from wormbase (www.wormbase.org).
very interesting- robert
Posted by robert Ross on 2008-06-05 15:13:57
I am trying to find someone who will continue this project. Contact me if you are interested.
Posted by on 2007-07-26 17:21:10