Home | Projects | Login or register:
Username:   Password:

Worm gene name:  daf-2
Worm sequence name:  Y55D5A.5
Related human gene:  Insulin receptor
Associated human disease:  Type II Diabetes
People involved in this project: 
Left primer sequence:  gtttcggaccgtgtgctatt
Right primer sequence:  agaacaactccgaagctcca
Size of PCR product:  541
Brief description:  C. elegans with defective daf-2 correspond to insulin resistance and Type II diabetes.
Report any problems that might have appeared and any solutions: 
View(1) or add comments