Worm gene name: | daf-2 |
Worm sequence name: | Y55D5A.5 |
Related human gene: | Insulin receptor |
Associated human disease: | Type II Diabetes |
People involved in this project: |
|
Left primer sequence: | gtttcggaccgtgtgctatt |
Right primer sequence: | agaacaactccgaagctcca |
Size of PCR product: | 541 |
Brief description: | C. elegans with defective daf-2 correspond to insulin resistance and Type II diabetes. |
Report any problems that might have appeared and any solutions: | |