| Worm gene name: | daf-2 |
| Worm sequence name: | Y55D5A.5 |
| Related human gene: | Insulin receptor |
| Associated human disease: | Type II Diabetes |
| People involved in this project: |
|
| Left primer sequence: | gtttcggaccgtgtgctatt |
| Right primer sequence: | agaacaactccgaagctcca |
| Size of PCR product: | 541 |
| Brief description: | C. elegans with defective daf-2 correspond to insulin resistance and Type II diabetes. |
| Report any problems that might have appeared and any solutions: | |
I tried to use the primers to make an amplicon at 50 and 55 degree C annealing temp. The PCR did not work at all and I had no band visible in the gel.