Home | Projects | Login or register:
Username:   Password:

Worm gene name:  lmn-1
Worm sequence name:  DY3.2
Related human gene:  lamin A
Associated human disease:  Hutchinson-Gilford progeria syndrome
People involved in this project: 
Left primer sequence:  aaatcgaagagatgcgtgct
Right primer sequence:  gcgcctcctgagtaagattg
Size of PCR product:  408
Brief description:  LMN-1 encodes the sole C. elegans nuclear lamin; LMN-1 protein is essential for the nuclear envelope localization of emerin (EMR-1) protein during early development. Disruption of the orthologous human gene LMNA, which produces the nuclear scaffolding protein lamin A,leads to cellular instability which causes premature aging seen in progeria.
Report any problems that might have appeared and any solutions: 
View(1) or add comments