Worm gene name: |
lmn-1
|
Worm sequence name: |
DY3.2
|
Related human gene: |
lamin A
|
Associated human disease: |
Hutchinson-Gilford progeria syndrome
|
People involved in this project: |
|
Left primer sequence: |
aaatcgaagagatgcgtgct
|
Right primer sequence: |
gcgcctcctgagtaagattg
|
Size of PCR product: |
408
|
Brief description: |
LMN-1 encodes the sole C. elegans nuclear lamin; LMN-1 protein is essential for the nuclear envelope localization of emerin (EMR-1) protein during early development. Disruption of the orthologous human gene LMNA, which produces the nuclear scaffolding protein lamin A,leads to cellular instability which causes premature aging seen in progeria.
|
Report any problems that might have appeared and any solutions: |
|
PCR using these primers with worm lysate failed to yield an amplicon.