| Worm gene name: | lmn-1 |
| Worm sequence name: | DY3.2 |
| Related human gene: | lamin A |
| Associated human disease: | Hutchinson-Gilford progeria syndrome |
| People involved in this project: |
|
| Left primer sequence: | aaatcgaagagatgcgtgct |
| Right primer sequence: | gcgcctcctgagtaagattg |
| Size of PCR product: | 408 |
| Brief description: | LMN-1 encodes the sole C. elegans nuclear lamin; LMN-1 protein is essential for the nuclear envelope localization of emerin (EMR-1) protein during early development. Disruption of the orthologous human gene LMNA, which produces the nuclear scaffolding protein lamin A,leads to cellular instability which causes premature aging seen in progeria. |
| Report any problems that might have appeared and any solutions: | |
PCR using these primers with worm lysate failed to yield an amplicon.