Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dys-1
Worm sequence name:  F15D3.1
Related human gene: 
Associated human disease:  Duchenne Muscular Dystrophy, OMIM 310200
People involved in this project: 
Left primer sequence:  aaaatcatcgtcatcctcgc
Right primer sequence:  ttcacaagatgcaagttcgc
Size of PCR product:  324
Brief description:  Dystrophin-associated muscular dystrophies range from the severe Duchenne muscular dystrophy (DMD) to the milder Becker muscular dystrophy (BMD; 300376). Mapping and molecular genetic studies indicate that both are the result of mutations in the huge gene that encodes dystrophin, also symbolized DMD. Approximately two-thirds of the mutations in both forms are deletions of one or many exons in the dystrophin gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments