| Worm gene name: | dys-1 |
| Worm sequence name: | F15D3.1 |
| Related human gene: | |
| Associated human disease: | Duchenne Muscular Dystrophy, OMIM 310200 |
| People involved in this project: |
|
| Left primer sequence: | aaaatcatcgtcatcctcgc |
| Right primer sequence: | ttcacaagatgcaagttcgc |
| Size of PCR product: | 324 |
| Brief description: | Dystrophin-associated muscular dystrophies range from the severe Duchenne muscular dystrophy (DMD) to the milder Becker muscular dystrophy (BMD; 300376). Mapping and molecular genetic studies indicate that both are the result of mutations in the huge gene that encodes dystrophin, also symbolized DMD. Approximately two-thirds of the mutations in both forms are deletions of one or many exons in the dystrophin gene. |
| Report any problems that might have appeared and any solutions: | |
