Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Col-135
Worm sequence name:  M199.5
Related human gene:  Col29A1
Associated human disease:  Atopic Dermatitis or Eczema
People involved in this project: 
Left primer sequence:  gggatagtcgttcccatgaa
Right primer sequence:  ttcgaaccagggttaccatc
Size of PCR product:  553
Brief description:  Atopic Dermatitis or eczema is an inflammatory disease that begins early in life. Symptoms of eczema include inflammation in the epidermal layer of your skin. Many different loci on a number of different chromosomes are associated with eczema but I chose gene Col29A1 which is associated with eczema. Col29A1 belongs to a class of collagen fibers. This collagen forms filaments that assist in the organization of tissue architechure and cell adhesion. After comparing this gene in worm base, I identified Col-135 in C. elegans. Little is known about worm gene Col-135 other than it is referred to as a collagen-binding protein gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments