| Worm gene name: | Col-135 |
| Worm sequence name: | M199.5 |
| Related human gene: | Col29A1 |
| Associated human disease: | Atopic Dermatitis or Eczema |
| People involved in this project: |
|
| Left primer sequence: | gggatagtcgttcccatgaa |
| Right primer sequence: | ttcgaaccagggttaccatc |
| Size of PCR product: | 553 |
| Brief description: | Atopic Dermatitis or eczema is an inflammatory disease that begins early in life. Symptoms of eczema include inflammation in the epidermal layer of your skin. Many different loci on a number of different chromosomes are associated with eczema but I chose gene Col29A1 which is associated with eczema. Col29A1 belongs to a class of collagen fibers. This collagen forms filaments that assist in the organization of tissue architechure and cell adhesion. After comparing this gene in worm base, I identified Col-135 in C. elegans. Little is known about worm gene Col-135 other than it is referred to as a collagen-binding protein gene. |
| Report any problems that might have appeared and any solutions: | |
