Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Y11B2A.8
Worm sequence name:  Y11B2A.8
Related human gene:  PRKAG2;062743
Associated human disease:  Wolff-Parkinson-White Syndrome
People involved in this project: 
Left primer sequence:  caccaatcggtgaacttgtg
Right primer sequence:  agacgtgtgccacgtgtaaa
Size of PCR product:  527
Brief description:  WPW can be caused by a mutation in the gamma-2 regulatory subunit of AMP-activated protein kinase. Features: short PR interval and prolonged QRS on EKG; slurred upstroke of the R wave called a delta wave; causng paroxysmal supraventricular tachycardia. Gene map locus 7q36. NCBI #NP_001035723 AMP-activated kinase gamma 2 subunit isoform C. Worm sequence Y11B2A.8 is orthologous to the human gene AMP-activated protein kinase gamma subunit (PRKAG2:OMIM 602743), which when mutated leads to disease.
Report any problems that might have appeared and any solutions: 
View(1) or add comments