| Worm gene name: | Y11B2A.8 |
| Worm sequence name: | Y11B2A.8 |
| Related human gene: | PRKAG2;062743 |
| Associated human disease: | Wolff-Parkinson-White Syndrome |
| People involved in this project: |
|
| Left primer sequence: | caccaatcggtgaacttgtg |
| Right primer sequence: | agacgtgtgccacgtgtaaa |
| Size of PCR product: | 527 |
| Brief description: | WPW can be caused by a mutation in the gamma-2 regulatory subunit of AMP-activated protein kinase. Features: short PR interval and prolonged QRS on EKG; slurred upstroke of the R wave called a delta wave; causng paroxysmal supraventricular tachycardia. Gene map locus 7q36. NCBI #NP_001035723 AMP-activated kinase gamma 2 subunit isoform C. Worm sequence Y11B2A.8 is orthologous to the human gene AMP-activated protein kinase gamma subunit (PRKAG2:OMIM 602743), which when mutated leads to disease. |
| Report any problems that might have appeared and any solutions: | |
08-22-08: Silencing Genes Workshop, Austin CC. I attempted to insert prepared primer into vector/bacteria but was unsuccessful at preparing vector.