Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dcr-1
Worm sequence name:  K12H4.8
Related human gene:  Dicer 1
Associated human disease:  TBD
People involved in this project: 
Left primer sequence:  ggtgatgaattggatgggac
Right primer sequence:  actgctaacgacgcgaaaat
Size of PCR product:  396
Brief description:  What happens if an extra copy of dicer is added to the genome? Does the silencer get silenced?
Report any problems that might have appeared and any solutions: 
View(0) or add comments