Worm gene name: | dcr-1 |
Worm sequence name: | K12H4.8 |
Related human gene: | Dicer 1 |
Associated human disease: | TBD |
People involved in this project: |
|
Left primer sequence: | ggtgatgaattggatgggac |
Right primer sequence: | actgctaacgacgcgaaaat |
Size of PCR product: | 396 |
Brief description: | What happens if an extra copy of dicer is added to the genome? Does the silencer get silenced? |
Report any problems that might have appeared and any solutions: | |