| Worm gene name: | dcr-1 |
| Worm sequence name: | K12H4.8 |
| Related human gene: | Dicer 1 |
| Associated human disease: | TBD |
| People involved in this project: |
|
| Left primer sequence: | ggtgatgaattggatgggac |
| Right primer sequence: | actgctaacgacgcgaaaat |
| Size of PCR product: | 396 |
| Brief description: | What happens if an extra copy of dicer is added to the genome? Does the silencer get silenced? |
| Report any problems that might have appeared and any solutions: | |
