Home | Projects | Login or register:
Username:   Password:

Worm gene name:  lgc-37
Worm sequence name:  C. elegans zc482.5
Related human gene:  NP_775807
Associated human disease:  Autism
People involved in this project: 
Left primer sequence:  aagatgggcattttggtcag
Right primer sequence:  tgctgctttcacagccatac
Size of PCR product:  589
Brief description:  Autism, the prototypic pervasive developmental disorder (PDD), is usually apparent by 3 years of age. It is characterized by a triad of limited or absent verbal communication, a lack of reciprocal social interaction or responsiveness, and restricted, stereotypical, and ritualized patterns of interests and behavior (Bailey et al., 1996; Risch et al., 1999). Autism is considered to be a complex multifactorial disorder involving many genes. Accordingly, several loci have been identified, some or all of which may contribute to the phenotype. (http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=209850)
ZC482.5 is orthologous to the human gene GAMMA-AMINOBUTYRIC ACID A RECEPTOR GAMMA 2 (GABRG2; OMIM:137164), which when mutated leads to disease.
Report any problems that might have appeared and any solutions: 
View(0) or add comments