| Worm gene name: | lgc-37 |
| Worm sequence name: | C. elegans zc482.5 |
| Related human gene: | NP_775807 |
| Associated human disease: | Autism |
| People involved in this project: |
|
| Left primer sequence: | aagatgggcattttggtcag |
| Right primer sequence: | tgctgctttcacagccatac |
| Size of PCR product: | 589 |
| Brief description: | Autism, the prototypic pervasive developmental disorder (PDD), is usually apparent by 3 years of age. It is characterized by a triad of limited or absent verbal communication, a lack of reciprocal social interaction or responsiveness, and restricted, stereotypical, and ritualized patterns of interests and behavior (Bailey et al., 1996; Risch et al., 1999). Autism is considered to be a complex multifactorial disorder involving many genes. Accordingly, several loci have been identified, some or all of which may contribute to the phenotype. (http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=209850)
ZC482.5 is orthologous to the human gene GAMMA-AMINOBUTYRIC ACID A RECEPTOR GAMMA 2 (GABRG2; OMIM:137164), which when mutated leads to disease. |
| Report any problems that might have appeared and any solutions: | |

