Home | Projects | Login or register:
Username:   Password:

Worm gene name:  nlg-1
Worm sequence name:  C40C9.5a
Related human gene:  neuroligin-3
Associated human disease:  Autism
People involved in this project: 
Left primer sequence:  gatgaagttcgcaaagaggc
Right primer sequence:  cacttggtttgggctttgtt
Size of PCR product:  731
Brief description:  Autism spectrum disorder is a developmental disorder characterized by impaired social interactions & communication skills along with repetitive activities and limited interests. The exact genetic cause of autism is unknown, but is probably due to multigenic interactions or mutations. A small percentage of cases of autism have been linked to a mutation in the neuroligin-3 proteins. These transmembrane proteins are involved in the formation of functional synaptic junctions.
Report any problems that might have appeared and any solutions: 
View(0) or add comments