| Worm gene name: | nlg-1 |
| Worm sequence name: | C40C9.5a |
| Related human gene: | neuroligin-3 |
| Associated human disease: | Autism |
| People involved in this project: |
|
| Left primer sequence: | gatgaagttcgcaaagaggc |
| Right primer sequence: | cacttggtttgggctttgtt |
| Size of PCR product: | 731 |
| Brief description: | Autism spectrum disorder is a developmental disorder characterized by impaired social interactions & communication skills along with repetitive activities and limited interests. The exact genetic cause of autism is unknown, but is probably due to multigenic interactions or mutations. A small percentage of cases of autism have been linked to a mutation in the neuroligin-3 proteins. These transmembrane proteins are involved in the formation of functional synaptic junctions. |
| Report any problems that might have appeared and any solutions: | |
