Home | Projects | Login or register:
Username:   Password:

Worm gene name:  pmp-4
Worm sequence name:  T02D1.5
Related human gene: 
Associated human disease:  Breast Cancer
People involved in this project: 
Left primer sequence:  ccgctcaacattcctaccat
Right primer sequence:  tcatgaccattccagttcca
Size of PCR product:  375
Brief description:  Right primer starts at 1121 and left primer starts at 1495. Both primers are 20 bases each.
Report any problems that might have appeared and any solutions: 
View(1) or add comments