Worm gene name: | pmp-4 |
Worm sequence name: | T02D1.5 |
Related human gene: | |
Associated human disease: | Breast Cancer |
People involved in this project: |
|
Left primer sequence: | ccgctcaacattcctaccat |
Right primer sequence: | tcatgaccattccagttcca |
Size of PCR product: | 375 |
Brief description: | Right primer starts at 1121 and left primer starts at 1495. Both primers are 20 bases each. |
Report any problems that might have appeared and any solutions: | |