| Worm gene name: | pmp-4 |
| Worm sequence name: | T02D1.5 |
| Related human gene: | |
| Associated human disease: | Breast Cancer |
| People involved in this project: |
|
| Left primer sequence: | ccgctcaacattcctaccat |
| Right primer sequence: | tcatgaccattccagttcca |
| Size of PCR product: | 375 |
| Brief description: | Right primer starts at 1121 and left primer starts at 1495. Both primers are 20 bases each. |
| Report any problems that might have appeared and any solutions: | |
