| Worm gene name: | pmp-4 |
| Worm sequence name: | T02D1.5 |
| Related human gene: | |
| Associated human disease: | Breast Cancer |
| People involved in this project: |
|
| Left primer sequence: | ccgctcaacattcctaccat |
| Right primer sequence: | tcatgaccattccagttcca |
| Size of PCR product: | 375 |
| Brief description: | Right primer starts at 1121 and left primer starts at 1495. Both primers are 20 bases each. |
| Report any problems that might have appeared and any solutions: | |
Status 8/7: My initial attempt at amplification using the suggested 60oC annealing step yielded negative results (no amplification of the gene in question occurred). Testing of these specific primers was conducted at CSHL before the workshop in which amplification occurred as expected. Due to this, it was hypothesized that our negative results may be due to a difference in the temperature regulation of the thermocycler here at VT as compared to those at CSHL. Using this information, we attempted a second amplification using the same primers at a temperature of 55oC during the annealing step of the process. This second attempt at amplification also yielded negative results. To date, the pmp-4 gene has not been amplified or further studied. An amplicon needs to be produced and cloned into the T-tailed vector and then subcloned into the RNAi expression vector.