Worm gene name:  hmr-1
Worm sequence name:  WO2B9.1
Related human gene:  Cadherin 1
Associated human disease:  Cleft Palet, CLEFT LIP
People involved in this project: 
Left primer sequence:  cacatacctcgtatgccacg
Right primer sequence:  gtgagctgcgtcgttatcaa
Size of PCR product:  500
Brief description:  Cadherins are glycoproteins involved in Ca2+-mediated cell-cell adhesion; these domains occur as repeats in the extracellular regions which are thought to mediate cell-cell contact when bound. Even though Cleft Palet or Cleft Lip are congenital defects curing this early in the pregnancy would be ideal.
to calcium
Report any problems that might have appeared and any solutions: 
Media attachments: 
  • Diagram of sagittal sections of palate formation  Diagram of sagittal sections of palate formation
View(0) or add comments