| Worm gene name: | hmr-1 |
| Worm sequence name: | WO2B9.1 |
| Related human gene: | Cadherin 1 |
| Associated human disease: | Cleft Palet, CLEFT LIP |
| People involved in this project: |
|
| Left primer sequence: | cacatacctcgtatgccacg |
| Right primer sequence: | gtgagctgcgtcgttatcaa |
| Size of PCR product: | 500 |
| Brief description: | Cadherins are glycoproteins involved in Ca2+-mediated cell-cell adhesion; these domains occur as repeats in the extracellular regions which are thought to mediate cell-cell contact when bound. Even though Cleft Palet or Cleft Lip are congenital defects curing this early in the pregnancy would be ideal.
to calcium |
| Report any problems that might have appeared and any solutions: | |
| Media attachments: |
|
