Home | Projects | Login or register:
Username:   Password:

Worm gene name:  D2023.5
Worm sequence name:  D2023.5
Related human gene:  MPT- mercaptopyruvate sulfur transferase
Associated human disease:  unknown
People involved in this project: 
Left primer sequence:  tgctcaaatggttggattga
Right primer sequence:  cacgaattctgctgtccaga
Size of PCR product:  1073
Brief description:  Mercaptopyruvate sulfur transferase transfers sulfur ion from 3' sulfur of mercaptopyruvate to a variety of acceptors. Physiological acceptor is unknown. Cyanide is one known acceptor in mamals. D2023.5 is the worm homolog gene. Wormbase says that RNAi experiments produce infertile progeny.
Report any problems that might have appeared and any solutions:  eRNAi program produced several primer sets that appear to have equal efficency. Problem is that no distinct (visible) phenotype is produced.
View(0) or add comments