| Worm gene name: | D2023.5 |
| Worm sequence name: | D2023.5 |
| Related human gene: | MPT- mercaptopyruvate sulfur transferase |
| Associated human disease: | unknown |
| People involved in this project: |
|
| Left primer sequence: | tgctcaaatggttggattga |
| Right primer sequence: | cacgaattctgctgtccaga |
| Size of PCR product: | 1073 |
| Brief description: | Mercaptopyruvate sulfur transferase transfers sulfur ion from 3' sulfur of mercaptopyruvate to a variety of acceptors. Physiological acceptor is unknown. Cyanide is one known acceptor in mamals. D2023.5 is the worm homolog gene. Wormbase says that RNAi experiments produce infertile progeny. |
| Report any problems that might have appeared and any solutions: | eRNAi program produced several primer sets that appear to have equal efficency. Problem is that no distinct (visible) phenotype is produced. |
