| Worm gene name: | ATM-1 |
| Worm sequence name: | Y48G1BL.2 |
| Related human gene: | ATM |
| Associated human disease: | Ataxia T |
| People involved in this project: |
|
| Left primer sequence: | cccgattctgattgaaggaa |
| Right primer sequence: | ttttctggggaaaatcaacg |
| Size of PCR product: | 956 |
| Brief description: | Ataxia T is an autosomal recessive human disease that causes immune defects, predisposition to canacer & supersensitivity to ionizing radiation. AT develops in chilrdern 3-5 years old & oldest reported patients died at age 52 and 49. Breast cancer in women is closely associated with heterozgote AT genotype
AT gene codes for PI3/PI4 kinase, which phosphorylates many downstream proteins (ex. p 53, BRCA1, other DNA repair proteins)during cell cycle checkpoint control. Thus, the human AT protein is considered a master regualtor of resposne to DNA damage & genome stability In C. elegans, ATM-1 gene is homologous to the human AT gene with an E value of 3e63 |
| Report any problems that might have appeared and any solutions: | using the default setting on e-RNAi to design primers will NOT work for this gene or other genes that are long. you must change the amplicon length from the given 300 - 500 b to 500-1000 b, otherwise you will not be given a value for % spcificity |
