Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ATM-1
Worm sequence name:  Y48G1BL.2
Related human gene:  ATM
Associated human disease:  Ataxia T
People involved in this project: 
Left primer sequence:  cccgattctgattgaaggaa
Right primer sequence:  ttttctggggaaaatcaacg
Size of PCR product:  956
Brief description:  Ataxia T is an autosomal recessive human disease that causes immune defects, predisposition to canacer & supersensitivity to ionizing radiation. AT develops in chilrdern 3-5 years old & oldest reported patients died at age 52 and 49. Breast cancer in women is closely associated with heterozgote AT genotype
AT gene codes for PI3/PI4 kinase, which phosphorylates many downstream proteins (ex. p 53, BRCA1, other DNA repair proteins)during cell cycle checkpoint control. Thus, the human AT protein is considered a master regualtor of resposne to DNA damage & genome stability In C. elegans, ATM-1 gene is homologous to the human AT gene with an E value of 3e63
Report any problems that might have appeared and any solutions:  using the default setting on e-RNAi to design primers will NOT work for this gene or other genes that are long. you must change the amplicon length from the given 300 - 500 b to 500-1000 b, otherwise you will not be given a value for % spcificity
View(0) or add comments