Home | Projects | Login or register:
Username:   Password:

Worm gene name:  epi-1
Worm sequence name:  K08C7.2 B
Related human gene:  LAMA3
Associated human disease:  Epidermolysis bullosa
People involved in this project: 
  • Susan Groff, Middle College High School @ Santa Ana College, CA
Left primer sequence:  gatggatgcagaagctgtga
Right primer sequence:  tcatcagcacgaacaaaagc
Size of PCR product:  974
Brief description:  epi-1 encodes an extracellular laminin. We constructed a feeding vector using the noted gene-specific primers and transformed this vector into the feeding strain.
Report any problems that might have appeared and any solutions: 
View(2) or add comments