| Worm gene name: | epi-1 |
| Worm sequence name: | K08C7.2 B |
| Related human gene: | LAMA3 |
| Associated human disease: | Epidermolysis bullosa |
| People involved in this project: |
|
| Left primer sequence: | gatggatgcagaagctgtga |
| Right primer sequence: | tcatcagcacgaacaaaagc |
| Size of PCR product: | 974 |
| Brief description: | epi-1 encodes an extracellular laminin. We constructed a feeding vector using the noted gene-specific primers and transformed this vector into the feeding strain. |
| Report any problems that might have appeared and any solutions: | |
