| Worm gene name: | epi-1 |
| Worm sequence name: | K08C7.2 B |
| Related human gene: | LAMA3 |
| Associated human disease: | Epidermolysis bullosa |
| People involved in this project: |
|
| Left primer sequence: | gatggatgcagaagctgtga |
| Right primer sequence: | tcatcagcacgaacaaaagc |
| Size of PCR product: | 974 |
| Brief description: | epi-1 encodes an extracellular laminin. We constructed a feeding vector using the noted gene-specific primers and transformed this vector into the feeding strain. |
| Report any problems that might have appeared and any solutions: | |
In C. elegans Epi-1 codes for a glycoprotein of the extracellular matrix and is involved in very diverse functions such as gonad development, cell migration, axon extensions, morphology of motor neurons, and body muscle structure. I picked healthy worms to a plate with E. coli containing a feeding vector with Epi-1. After a few days the worms only moved very slowly, they did not produce any offspring and overall seemed to be in very bad shape. The orthologues of Ep1-1 in the human genom are genes LAMA 1 through Lama 5. These genes code for different versions of the protein laminin, which is part of the extracellular matrix. These genes are associated with some very severe human disorders. I found links to epidermolyis bullosa, chronic lymphocytic leukemia, and muscular dystrophy. Also, certain skin cells use laminin 5 as a receptor for human papiloma viruses.
Follow-up RNAi by feeding showed egg-laying defects, slow movement, and (tentatively) L3 arrest. These results needs to be confirmed.