Worm gene name: |
fum-1
|
Worm sequence name: |
H14A12.2a
|
Related human gene: |
Fumarate hydratase
|
Associated human disease: |
Fumarase deficiency
|
People involved in this project: |
|
Left primer sequence: |
gaaacaccgaaggcatgaat
|
Right primer sequence: |
tttcagcgatttcagctcct
|
Size of PCR product: |
901
|
Brief description: |
Fumarase, or fumarate hydratase (FH), is an enzyme involved in the Krebs cycle, where it catalyzes the formation of L-malate from fumarate. We amplified part of the fum-1 gene in C. elegans, cloned the amplicon into the RNAi feeding vector, and transformed the vector into the RNAi feeding strain. Preliminarily, we observed slow growth in worms fed this RNAi strain, suggesting that fum-1 is required for normal growth rates.
|
Report any problems that might have appeared and any solutions: |
None so far.
|
Media attachments: |
|