Worm gene name:  fum-1
Worm sequence name:  H14A12.2a
Related human gene:  Fumarate hydratase
Associated human disease:  Fumarase deficiency
People involved in this project: 
Left primer sequence:  gaaacaccgaaggcatgaat
Right primer sequence:  tttcagcgatttcagctcct
Size of PCR product:  901
Brief description:  Fumarase, or fumarate hydratase (FH), is an enzyme involved in the Krebs cycle, where it catalyzes the formation of L-malate from fumarate. We amplified part of the fum-1 gene in C. elegans, cloned the amplicon into the RNAi feeding vector, and transformed the vector into the RNAi feeding strain. Preliminarily, we observed slow growth in worms fed this RNAi strain, suggesting that fum-1 is required for normal growth rates.
Report any problems that might have appeared and any solutions:  None so far.
Media attachments: 
  • Studying Fumarase Function in Worms by RNAi  Studying Fumarase Function in Worms by RNAi
     
I really liked this video production.
Posted by David Micklos on 2007-09-06 16:35:12
RNAi with this feeding strain gives slow growth and sterility.
Posted by on 2007-09-06 13:31:38