Home | Projects | Login or register:
Username:   Password:

Worm gene name:  C09G5.8
Worm sequence name:  C09G5.8
Related human gene:  RPGRIP1
Associated human disease:  Retinitis Pigmentosa
People involved in this project: 
Left primer sequence:  ccccaaacctacgactacga
Right primer sequence:  ataatccggcagtggaacag
Size of PCR product:  853
Brief description:  None
Report any problems that might have appeared and any solutions:  I designed these primers, however, when checking the PCR products I used 55 degrees C. This produced additional amplicons
View(0) or add comments