| Worm gene name: | C09G5.8 |
| Worm sequence name: | C09G5.8 |
| Related human gene: | RPGRIP1 |
| Associated human disease: | Retinitis Pigmentosa |
| People involved in this project: |
|
| Left primer sequence: | ccccaaacctacgactacga |
| Right primer sequence: | ataatccggcagtggaacag |
| Size of PCR product: | 853 |
| Brief description: | None |
| Report any problems that might have appeared and any solutions: | I designed these primers, however, when checking the PCR products I used 55 degrees C. This produced additional amplicons |
