Home | Projects | Login or register:
Username:   Password:

Worm gene name:  KO2D7.1
Worm sequence name:  K02D7.1
Related human gene:  NP
Associated human disease:  Deficiency of nucleoside phosphorylase resulting in defective T-cell immunity
People involved in this project: 
Left primer sequence:  tttagtgcaccctcccagtc
Right primer sequence:  ggcaagttgacattccgagt
Size of PCR product:  861
Brief description:  the gene has been inserted into L4440 and transformed into DH5-alpha E.coli cells. I have also plated this transformed cells for future studies under the label "#21", "DH5-alpha", K02D7.1", "Joseph". dated 7/26.
Report any problems that might have appeared and any solutions:  When i used the competent cells that have been prepared, i couldn't get any colonies after the transformation.
When I used the competent cells which I prepared on my own, there were colonies.
View(0) or add comments