| Worm gene name: | KO2D7.1 |
| Worm sequence name: | K02D7.1 |
| Related human gene: | NP |
| Associated human disease: | Deficiency of nucleoside phosphorylase resulting in defective T-cell immunity |
| People involved in this project: |
|
| Left primer sequence: | tttagtgcaccctcccagtc |
| Right primer sequence: | ggcaagttgacattccgagt |
| Size of PCR product: | 861 |
| Brief description: | the gene has been inserted into L4440 and transformed into DH5-alpha E.coli cells. I have also plated this transformed cells for future studies under the label "#21", "DH5-alpha", K02D7.1", "Joseph". dated 7/26. |
| Report any problems that might have appeared and any solutions: | When i used the competent cells that have been prepared, i couldn't get any colonies after the transformation.
When I used the competent cells which I prepared on my own, there were colonies. |
