Home | Projects | Login or register:
Username:   Password:

Worm gene name:  HMGN1
Worm sequence name:  163920
Related human gene: 
Associated human disease:  Heart disease
People involved in this project: 
Left primer sequence:  gagaccccgagcttgtcaag
Right primer sequence:  tggattgatataggcaagac
Size of PCR product:  80
Brief description:  we were to look for changes in the worms that could be linked with heart disease in humans.
Report any problems that might have appeared and any solutions: 
View(0) or add comments