Worm gene name: | HMGN1 |
Worm sequence name: | 163920 |
Related human gene: | |
Associated human disease: | Heart disease |
People involved in this project: |
|
Left primer sequence: | gagaccccgagcttgtcaag |
Right primer sequence: | tggattgatataggcaagac |
Size of PCR product: | 80 |
Brief description: | we were to look for changes in the worms that could be linked with heart disease in humans. |
Report any problems that might have appeared and any solutions: | |