| Worm gene name: | HMGN1 |
| Worm sequence name: | 163920 |
| Related human gene: | |
| Associated human disease: | Heart disease |
| People involved in this project: |
|
| Left primer sequence: | gagaccccgagcttgtcaag |
| Right primer sequence: | tggattgatataggcaagac |
| Size of PCR product: | 80 |
| Brief description: | we were to look for changes in the worms that could be linked with heart disease in humans. |
| Report any problems that might have appeared and any solutions: | |
