Worm gene name: | DYX1C1 |
Worm sequence name: | EKN1 |
Related human gene: | |
Associated human disease: | Dyslexia |
People involved in this project: |
|
Left primer sequence: | cgtgtcgagaccaggtaccg |
Right primer sequence: | tactttttggtgattaggaa |
Size of PCR product: | 80 |
Brief description: | We wer3 to search for an sign of change in a worm that might make a link to dyslexia |
Report any problems that might have appeared and any solutions: | |