Home | Projects | Login or register:
Username:   Password:

Worm gene name:  DYX1C1
Worm sequence name:  EKN1
Related human gene: 
Associated human disease:  Dyslexia
People involved in this project: 
Left primer sequence:  cgtgtcgagaccaggtaccg
Right primer sequence:  tactttttggtgattaggaa
Size of PCR product:  80
Brief description:  We wer3 to search for an sign of change in a worm that might make a link to dyslexia
Report any problems that might have appeared and any solutions: 
View(0) or add comments