| Worm gene name: | DYX1C1 |
| Worm sequence name: | EKN1 |
| Related human gene: | |
| Associated human disease: | Dyslexia |
| People involved in this project: |
|
| Left primer sequence: | cgtgtcgagaccaggtaccg |
| Right primer sequence: | tactttttggtgattaggaa |
| Size of PCR product: | 80 |
| Brief description: | We wer3 to search for an sign of change in a worm that might make a link to dyslexia |
| Report any problems that might have appeared and any solutions: | |
