Home | Projects | Login or register:
Username:   Password:

Worm gene name:  mdf-2
Worm sequence name:  Y69A2AR.30
Related human gene:  MAD2L1
Associated human disease:  MITOTIC ARREST-DEFICIENT 2, S. CEREVISIAE, HOMOLOG OF MAD2, S. CEREVISIAE, HOMOLOG OF
People involved in this project: 
Left primer sequence:  cagatttcggccttaacagc
Right primer sequence:  gcagctttgagccagttttc
Size of PCR product:  366
Brief description:  mdf-2 encodes the C. elegans ortholog of the Mad2p spindle assembly checkpoint protein; mdf-2 activity is essential for regulation of the anaphase-promoting complex (APC) during oocyte meiosis I as well as for normal brood size, growth rates, and embryonic, larval, and vulval development; in addition, mdf-2 is essential for mitotic spindle checkpoint activity in response to anoxia, in which microscopically visible movement ceases and cell cycle progression reversibly arrests; by genetic analyses and comparison to studies in budding yeast, MDF-2 likely negatively regulates APC activity by inhibiting the activity of the FZY-1/CDC20p APC co-activator.
Report any problems that might have appeared and any solutions: 
View(0) or add comments