Home | Projects | Login or register:
Username:   Password:

Worm gene name:  pdr-1
Worm sequence name:  K08E3.7
Related human gene:  PARK2
Associated human disease:  Early-Onset Parkinson's Disease
People involved in this project: 
Left primer sequence:  tgtacctcgtgtggaatgga
Right primer sequence:  caatgtaacttcagacacaccg
Size of PCR product:  172
Brief description:  Although there are multiple genes in humans that cause Parkinson's symptoms, the PARK2 gene (also known as parkin gene) is responsible for causing the Early-Onset Parkinson's symptoms (onset < 40 years old). Common symptoms between Early-Onset Parkinson's and Classical include bradykinesia, rigidity, and tremor. However, the two are otherwise quite different. Early-Onset can begin as early as in childhood, with symptoms such as a difficulty in walking far distances. A deletion of the PARK2 gene causes Early-Onset Parkinson's.
Report any problems that might have appeared and any solutions:  None currently known
View(0) or add comments