Home | Projects | Login or register:
Username:   Password:

Worm gene name:  DNC-1
Worm sequence name:  ZK593.5
Related human gene:  DCTN1
Associated human disease:  ALS
People involved in this project: 
Left primer sequence:  ttacaagcatggcaagacga
Right primer sequence:  ttgccatttcttctttcagga
Size of PCR product:  187
Brief description:  DNC-1 codes for the protein dynactin which is necessary for motor neuron activity. Without dynactin, microtubules do not function properly resulting in paralysis.
Report any problems that might have appeared and any solutions:  N/A
View(0) or add comments