| Worm gene name: | DNC-1 |
| Worm sequence name: | ZK593.5 |
| Related human gene: | DCTN1 |
| Associated human disease: | ALS |
| People involved in this project: |
|
| Left primer sequence: | ttacaagcatggcaagacga |
| Right primer sequence: | ttgccatttcttctttcagga |
| Size of PCR product: | 187 |
| Brief description: | DNC-1 codes for the protein dynactin which is necessary for motor neuron activity. Without dynactin, microtubules do not function properly resulting in paralysis. |
| Report any problems that might have appeared and any solutions: | N/A |
