Home | Projects | Login or register:
Username:   Password:

Worm gene name:  col-104
Worm sequence name:  F58F6.1
Related human gene:  col17a1
Associated human disease:  Epidermolysis Bullosa
People involved in this project: 
Left primer sequence:  gatcgccttctccctatcct
Right primer sequence:  gggcgagttgtctgtctctt
Size of PCR product:  207
Brief description:  Genetic disorder affecting collagen. In humans Epidermolysis Bullosa results in severe blistering.
Report any problems that might have appeared and any solutions:  Phenotypic changes observed included lighter pigmentation compared to wild type, a small yield of progeny, and 2 to 3 worms which displayed a cuticle blister.
A problem arose with the primer, in that, the DNA plasmid insert was of an unexpected size. However, since phenotypic change did result, it can be concluded that the primers did work.
Media attachments: 
  • col-104 knockdown  col-104 knockdown
     col-104 knockdown C. elegans with blister.
View(0) or add comments